ORIGINAL ARTICLE
THE DETECTION OF HELICOBACTER PYLORI IN GASTRIC MUCOSAL BIOPSY SPECIMENS BY PCR USING PRIMERS DERIVED FROM URE C GENE IN PATIENTS WITH DYSPEPSIA
Soewignjo Soemohardjo, I Gede Palgunadi , S. Gunawan,
Zainul Muttaqin, Haris Widita, and Wenny Astuti A
Department of Internal Medicine and Biomedical Research Unit
Mataram General Hospital
————————————————————————————————————
ABSTRACT
The detection of H. pylori in gastric biopsy specimens can be done using CLO (Campylobacter Like Organism) test and histopatological examination, but the sensitivity of both method is influenced by the density of the bacteria in the sample. In patient not stopping the antibiotic or acid suppresant drug before endoscopy the urease producing spiral shaped bacteria might be replaced by coccoid form that does not show urease activity and it is not detectable by CLO. Beside that, the coccoid form is detected with difficulty by histology and need immunohistochemical stain to confirm. PCR can be used for the detection of both spiral and coccoid form of the bacteria.
The objective of study : to detect the genome of H. pylori by PCR using primers derived from ureC gene of the bacteria in gastric biopsy specimen from patients with dyspepsia.
Material of the study : Gastric biopsy specimen from 179 patients with dyspepsia in the Endoscopic Unit Mataram General Hospital. The biopsy was taken from antrum and corpus and put into sterile saline for the culture of H. pylori and put into 70% ethanol solution for the PCR. The specimen for bacterial culture was carried soon to microbiology laboratory and plated into the apporirate media and grown in microaerophilic condition in CO2 incubator. The PCR was done using primers derived from ureC.
Result : The endoscopic appreance was normal in 35 patients (19.55%), gastric ulcer in 21 (11.73%), duodenal ulcer in 22 (12.29%). Combined gastric and duodenal ulcer in 7 (4%), gastric tumour in 3 (1.68%), erosive gastritis in 16 (8.94%), anthral gastritis in 45 (25.12%), esophagitis in 5 (2.79%), esophageal varices in 5 (2.79%), and other findings in 5 cases (2.79%). The H. pylori genome was detected in 79 of 179 biopsy sample (44.13%). The bacterial culture was positive for H. pylori in 22 (12%). The PCR result was positive in 10/35 of patient with normal endoscopy (28.57%). From 22 patient with duodenal ulcer without gastric ulcer the PCR was positive in 15 (68.18%). In patient with gastric ulcer without duodenal ulcer the PCR was positive in 9 patient (42.08%). From 7 patient with combined gastric and duodenal ulcer the PCR was positive in 5 (71.43%), in 3 patient with gastric cancer the PCR was positive in 1 (33.33%).
Conclusion : The study showed that 44.13% of patient with dyspepsia in Mataram General Hospital was positive for H. pylori by PCR. It suggest that H. pylori infection has a significant role in the development of dyspepsia cases in Mataram. In duodenal ulcer alone the positive rate of PCR was 68.18%, in gastric ulcer alone the rate was 42.86%, while in the combined gastric and duodenal ulcer the rate was 71.4%. In patient with functional dyspepsia the rate was 28.57%.
Key words : detection of H. pylori, gastric mucosal biopsy specimen, polymerase chain reaction, ureC gene
————————————————————————————————————
INTRODUCTION
The diagnosis of H. pylori infection can be done invasively using endoscopy and mucosal gastric biopsy and noninvasively using UBT (Urea Breath Test) or serologic detection of IgG anti-Helicobacter pylori. The detection of H. pylori in gastric biopsy specimens can be done using CLO (Campylobacter Like Organism) test and histopatological examination, but the sensitivity of both method is influenced by the density of the bacteria in the sample.(1,2) The problem is especially important in patient with long standing dyspepsia that might be treated with acid suppressing drug or antibiotic before endoscopy. In patient not stopping the antibiotic or acid suppresant drug several days before endoscopy the urease producing spiral shaped bacteria might be replaced by coccoid form that does not show urease activity and it is not detectable by CLO. Beside that, the coccoid form is detected with difficulty by histology and may need immunohistochemical stain to confirm. PCR can be used for the detection of both spiral and coccoid form of the bacteria. Recently it was found that the highest sensitivity and specificity of PCR can be achieved using primers derived from ureC gene.(3)
THE OBJECTIVE OF STUDY : to detect genome of H. pylori by PCR using primers derived from ureC gene of the bacteria in gastric biopsy specimen from patients with dyspepsia.
MATERIAL AND METHOD : Material of the study were gastric biopsy specimen from 179 patients with dyspepsia in the Endoscopic Unit Mataram General Hospital. The patient consist of 93 male and 86 female aged between 25 to 88 years The criteria used for dyspepsia is persistent or recurrent upper abdominal pain or discomfort supposed to be referable to the upper gastrointestinal tract.(4,5) The endoscopy is done without special preparation except fasting for 8 hours before endoscopy. The biopsy was taken from antrum and corpus and put into sterile saline for the culture of H. pylori and put into 70% ethanol solution for the PCR. The specimen for bacterial culture was carried soon to microbiology laboratory and picked up using sterile pincet and crushed and then swabbed on the surface of solid agar consisted of Trypticase Soy Agar (TSA) and added with Vitox (Oxoid #SR90A), Dent Supplement (Oxoid #SR 147) and 10% of fresh sheep red blood cell. The culture was incubated in microaerophilic condition (10% CO2, 85% N2, and 5% O2) in CO2 incubator for 5 days. Small, round, and transparant colony was pick up and subcultured for microscopic examination and biochemical test including urease test, catalase test and sugar test.(6)
The PCR was done using primers derived from gene ureC consisted of 5’ AAGCTTTTAGGGGTGTTAGGGGTTT3’ and 5’ AAGCTTACTTTCTAACACTAACGC3’.(7) DNA extraction was done using TRI-zol kit (invitrogen) a modification of Guanidium Isothiocyanate method. First, a piece of gastric tissue was put in a tube containing 300 uL Tri-Zol solution. The tissue was minced using the tip of a pointed pincet then vortexed for 1 minute. The tube was left in room temperature for 5 minutes. Into the tube was added 80 uL chloroform. The organic phase (upper phase) was pipeted into a new tube containing 200 uL absolute ethanol. The tube was shaken and than left in 2-80C for 1 hour. The DNA was sedimented by centrifuging in 14.000 rpm for 10 minutes and washed twice using 75% ethanol. It was dried by putting in room temperature for ½ hour. DNA was suspended using 50 uL aquabidest. Amplification was done using PCR Core II System (Promega Corp) with reaction volume of 50 uL, consisted of PCR buffer, MgC12 25 mM, dNTP mix, Primer, Taq polymerase 0,25 U and 5 uL DNA template. The amplification condition was predenaturation 940C 10 minutes, denaturation 940C 1 minute, annealing 450C 1 minute, extension 720C 3 minute. The reaction was amplified 35 cycle with the target amplification of 294 bp. Amplification was done using Amplitron I machine (Thermolyne).
Analyzis of PCR product was done using 2% agarose gel with Tris Borate buffer in 100 V for 1 hour. The observation of DNA bands was done using ethidium bromide staining and UV light. The DNA bp size was measured using Low DNA Mass Ladder (Invitrogen, USA).
RESULT : The endoscopic appreance was normal in 35 (19.55%), gastric ulcer in 21 (11.73%), duodenal ulcer in 22 (12.29%). Combined gastric and duodenal ulcer in 7 (4%), gastric tumour in 3 (1.68%), consisted of 2 tumour of cardia and 1 prepyloric tumour, erosive gastritis in 16 (8.94%), anthral gastritis in 45 (25.12%), pangastritis in 2 (1.12%), esophagitis in 5 (2.79%), esophageal varices in 5 (2.79%), duodenitis in 11 patients (6.15%), and other endoscopic finding in 5 cases (2.79%). The endoscopic finding can be seen in table 1.
The H. pylori genome was detected in 79 of 179 biopsy sample (44.13%). It was positive in 46 of male (58.23 %) and in 33 of female (41.77 %). The PCR result was positive in 10/35 of patient with normal endoscopy (28.57%), 20/29 of all patient with duodenal ulcer (68.97%), 14/28 of all patient with gastric ulcer (50%). From 22 patient with duodenal ulcer without gastric ulcer the PCR was positive in 15 (68.18%). In patient with gastric ulcer without duodenal ulcer the PCR was positive in 9 patient (42.86%). From 7 patient with combined gastric and duodenal ulcer the PCR was positive in 5 (71.43%), in 3 patient with gastric cancer the PCR was positive in 1 (33.3%). The gastric cancer consisted of 1 patient with cancer of cardia with negative PCR in 2 cases of prepyloric cancer and 1 of the cases was PCR positive (50%). All 2 patients with pangastritis were PCR positive (100%). The frequency of PCR positive in patient with each endoscopic diagnosis can be seen in table 2.
The bacterial culture was positive for H. pylori in 22 (12.29%). From 22 patient with duodenal ulcer 5 patient showed positive culture of H. pylori.
DISCUSSION : In invasive diagnosis of H. pylori infection the frequently used diagnostic were CLO test and detection of H. pylori by histology, but it was known that both CLO and histology is affected by the density of H. pylori in the gastric tissue. For example, in patient taking acid suppressing drug for long time and the drug was not stopped for several days before endoscopy, the density of spiral bacteria showing urease activity decrased significantly(8) that may caused the false negative CLO test. In the past it was thought that this phenomena was caused by anti-H. pylori effect of the acid suppressant. Later the anti-H. pylori effect can be explained by the change of spiral bacteria into coccoid form and it was proven that coccoid form of H. pylori does not show urease activity despite intact urease genes and production of urease protein.(9) This change is not a permanent one and the coccoid form can change into spiral form again if the acid suppressant is stopped for several days. In patient with H. pylori infection where due to administration of acid suppressant or antibiotic the spiral form of the bacteria change to coccoid form, the detection of H. pylori by histology can be difficult, because in the histologic detection of H. pylori the spiral form should be detected. The detection of coccoid form need immunohistochemistry. Beside that it was also known that detection H. pylori by histology is relatively subjective and depund of the degree of expertise of the pathologist.(10,11)
This study showed the significant role of H. pylori infection in the development of dyspepsia in Lombok Island. The big role of H. pylori can be seen in the duodenal ulcer without concomitant gastric ulcer with the rate of positive PCR of 68.18%. In gastric ulcer without concomitant duodenal ulcer the rate was 42.86% much lower than duodenal ulcer. While in duodenal ulcer combined with gastric ulcer the rate of positive PCR was 71.74%. With the detection H. pylori by PCR we can detect spiral and coccoid form, and this is one of the superiority of PCR over CLO test and histology that can not detect the cocoid form.(12) The ureC gene is relatively conserved so that the primer derived from this gene is considered to be better compared with the other urease gene such as ureA and ureB.(3,6,13)
Some studies showed that PCR is more sensitive for the detection of H. pylori infection compared with histology especially in cases were the density of the bacteria is low.(14) In patient with long standing dyspepsia that might have been treated by acid suppressing drug PCR is more sensitive compared with histology or Urea Breath Test.
A very interesting fact in this study was the low rate of positive culture of H. pylori. The rate of positive culture was much less compared with PCR. It was known that H. pylori coccoid form is very difficult to be grown invitro.
CONCLUSION : The study showed that 44.13% of patient with dyspepsia in Mataram General Hospital was positive for H. pylori by PCR. It suggest that H. pylori infection has a significant role in the development of dyspepsia cases in Mataram. In duodenal ulcer alone the positive rate of PCR was 68.18%, in gastric ulcer alone the rate was 42.86%, while in the combined gastric and duodenal ulcer the rate was 71.4%. In patient with functional dyspepsia the rate was 28.57%.
REFERENCES
(1). Tokunaga Y, Shirahase H, Yamamoto E, Inao R, Hamaguchi S, et al. Helicobacter pylori and modified Urease Test; Modified rapid urease test for Helicobacter pylori detection in relation to an immunohistochemical stain. J Gastroenterol Hepatol, 2000; 15; 6:617
(2). Logan R P H and Walker M M. Epidemiology and diagnosis of Helicobacter pylori infection (Clinical review). BMJ 2001;323:920-922
(3). Bickley J, Owen R J, Fraser A G, Pounder E. Evaluation of the polymerase chain reaction for detecting the urease C gene of Helicobacter pylori in gastric biopsy samples and dental plaque. The Journal of Medical Microbiology, 1993;39: 338-344
(4). Veldhuyzen S J, Flook N, Chiba N, Armstrong D, et al. An evidence-based approach to the management of uninvestigated dyspepsia in the era of Helicobacter pylori. CMAJ 2000 June 13; 162(12):S3-S23
(5). Arents N L A, Thijs JC, Kleibeuker J H. A rational approach to uninvestigated dyspepsia in primary care : review of the literature. Medical Journal 2002; 78:707-716
(6). Ansorg R, Recklinghausen G V, Pomarius R, and Schmid E N. Evaluation of Techniques for Isolation, Subcultivation, and Preservation of Helicobacter pylori. Journal of Clinical Microbiology, 1991,p.51-53
(7). Lu J J, Perng C L, Shyu R Y, Chen C H, Lou Q, Chong S K.F, and Lee C H. Comparison of Five PCR Methods for Detection of Helicobacter pylori DNA in Gastric Tissue. J Clin Microbiol, 1999; 37; 3: 772-774
(8). Mizoguchi H, Fujioka T, Kishi K, Nishizono A, Reiji K and Nasu M. Diversity in Protein Synthesis and Viability of Helicobacter pylori Coccoid Forms in Response to various Stimuli. Infect Immun, 1998; 66(11) : 5555-5560.
(9). Jekti D S D : The effect of aerobiosis and antibiotic on the characteristic, virulence, resistance and ultrastructure of coccoid form of H. pylori (Dissertation). Post graduate program, Airlangga University, Surabaya, Indonesia 2003
(10). Hua J, Ho B, Zheng P, Yeoh K G, NG H C, Kim S G. Coexistence of Helicobacter pylori spiral and coccoid forms in experimental mice. WJG, 1998; 4(6):485-488
(11). Rotimi O, Cairns A, Gray S, Moayyedi P and Dixon M F. Histological identification of Helicobacter pylori : comparison of staining methods. J. Clin. Pathol, 2000;53:756-759
(12). Ren Z, Pang G, Batey R, Routiey D, Russeli A, Musicka M, Dunkley M, Beagley K, Ciancy R. Non-urease producing Helicobacter pylori in chronic gastritis. Aust N Z J Med, 2000; 30 (5): 578-84
(13). De Reuse H, Labigne A, and Mengin-Lecreulx D. The Helicobacter pylori ureC Gene Codes for a Phosphoglucosamine Mutase. Journal of Bacteriology, June 1997;179;11: 3488-3493
(14). Cesar A C B, Cury P M, Payao S L M, Liberatore P R, Silva A E. Comparison of Histological and Molecular Diagnosis of Helicobacter pylori in Benign Lesions and Gastric Adenocarcinoma. Brazilian Journal of Microbiology (2005) 36:12-16
Prof. DR. Dr. Soewignjo Soemohardjo, Sp.PD-KGEH
Biomedical Clinic
Bung Karno street Num. 143
Mataram West Nusa Tenggara Indonesia
Email : Soewignjo@gmail.com
http://biomedikamataram.wordpress.com


